Haplogroup R1b (Y-DNA)

From MedBib.com - Medicine & Nature

Haplogroup R1b

Time of origin less than 18,500 years BP[1]
Place of origin Central Asia
Ancestor Haplogroup R1
Defining mutations M343
Typical members People of Atlantic Europe (Welsh 89%, Basque 88%, Irish 81%, Northern Portuguese 81% Portugal, Catalan 79%, Scottish 77%, English 75%, Dutch 70%, Italian 50% etc.)
Haplogroup R1b Distribution

In human genetics, Haplogroup R1b is the most frequent Y-chromosome haplogroup in Western Europe, where its frequency is highest.

More specifically, its frequency is highest in Atlantic Europe and, due to European emigration, in North America, South America, and Australia. In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Spain, Portugal, France, Wales, Scotland, and Ireland the frequency of R1b is greater than 90%. It is also found among Italians, particularly in northern Italy.

R1b is also present at lower frequencies throughout Eastern Europe, Anatolia and also appears in certain ethnic groups of North Africa where its frequency reaches 40% in Sudanese Hausa[2] and surpasses 10% in Algerian Arabs[3].

Haplogroup R1b is defined by the presence of single nucleotide polymorphism (SNP) M343, which was discovered in 2004.[4] From 2002 to 2005, R1b was defined by the presence of SNP P25. Prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[5]

Contents

Origins

R1b was once believed to have originated in western Europe where it reaches its highest frequencies. However, research now shows that R1b's variance increases as one moves east, leading to the competing view that R1b likely originated further east than previously thought. Geneticists now generally believe that R1b arose in Central Asia[6] or Southwest Asia.[7]

By 2008, T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP.[8]

Subclades

R1b is a descendant of Haplogroup R1, which is defined by the presence of SNP marker M173.

Systematic descent-based names of the subclades have been changing rapidly with the discovery of new SNPs clarifying and augmenting the descent tree. The indentifiers below are those from the November 2008 revision of the ISOGG tree.


M343
P25

R-M18 (R1b1a)


P297

R-M73 (R1b1b1)


M269
P311
P310
U106

R-U198 (R1b1b2a1a1)



R-S26 (R1b1b2a1a2)



R-L44 (R1b1b2a1a4)



R-U106* (R1b1b2a1a*)



P312

R-M153 (R1b1b2a1b2)



R-M167 (R1b1b2a1b3)


U152
L2

R-L20 (R1b1b2a1b4c1)



R-L2* (R1b1b2a1b4c*)




R-U152* (R1b1b2a1b4*)




R-S68 (R1b1b2a1b5)


L21

R-M222 (R1b1b2a1b6b)



R-L21* (R1b1b2a1b6*)




R-P312* (R1b1b2a1b*)




R-P310* (R1b1b2a1*)




R-P311* (R1b1b2a*)




R-M269* (R1b1b2*)




R-P297* (R1b1b*)




R-P25* (R1b1*)




R-M343* (R1b*)




R1b1b2

R-M269
Long-hand: R1b1b2 (formerly R1b1c, R1b3)
Defining SNP: M269
Parent Clade: R-P297
Subclades: R-P311

Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1b2 subclade.

This subgroup is believed by some to have existed before the last Ice Age and has been associated with the Aurignacian culture[9] (32,000 - 21,000 BC). Archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau.[10] Traditionally this culture is associated with the Cro-Magnon people, the first modern humans to enter Europe, however, this view has recently been challenged.[11] However, a link to the Aurignacian culture is unlikely as new age estimates suggest that R1b's parent, R1, is only about 18,500 years old.[12]

Although the precise route of the M269 marker is not known, it is theorized to have originated in Central Asia/South Central Siberia. It could have entered prehistoric Europe from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea.[6] It is considered to have entered Europe sometime after the Last Glacial Maximum.[7]

European LGM refuges, 20 kya.

The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian Peninsula (Portugal and Spain), where the R1b1b2 haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.[11]

Arredi, Poloni and Tyler-Smith (2007) favor a Neolithic, rather than Paleolithic, entry of M269 into Europe. Their analysis suggests M269's age to be roughly 5-8 thousand years.[13]

A second R1b1b2 population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1.

(In earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time [from 2003 to 2005] what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c. This shows how nomenclature can evolve as new markers are discovered and then investigated).

R1b1b2a1a

R-U106
Long-hand: R1b1b2a1a, formerly R1b1c9
Defining SNP: U106 (also called S21, M405)
Parent Clade: R-P310
Subclades: R-U198, R-S26, R-L44

The R-U106 subclade appears to be about in over 25% of R1b. It was discovered by Gareth Henson and was quickly set up as a test offered by EthnoAncestry. This group has a maximum in Frisia (the Netherlands). The U106 subclade may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland.[12] A close match of the present – day distribution of S21 and the territorial pattern of the Eastern Corded Ware cultures and the Single Grave cultures has been observed.[14]

In Europe, the subclade (including downstream S29) has a global distribution going north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in Italy (3.5%), the Balkan and Turkey.[15]

The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) [13]. Family Tree DNA started to test the U152 and U106 on 21 February 2008.

Craig Venter and James Watson, who in 2007 became the first two individuals to have their complete genomes published, both belong to this subclade.

Downsteam of U106, the R-U198 subclade was discovered by EthnoAncestry. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Only low values of the marker have been detected over a wide area that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[15]

Also downsteam of U106, the L1/S26 subclade occurs in less than half of a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry, is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null439". FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at [14].

R1b1b2a1b

R-P312
Long-hand: R1b1b2a1b
Defining SNP: P312 (also called S116, rs34276300)
Parent Clade: R-P310
Subclades: R-M153, R-M167, R-U152, R-L21

The P312 SNP is downstream of M269 and upstream of the M37, M65, M153, M167, M222 and U152 SNPs, but not U106. It appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of S116 relative to the above list.

R-M153: This haplogroup has been found mostly in Basques and Gascons, among whom it makes a sizeable fraction of the Y-DNA pool[16][17][18], though is also found occasionally among Iberians in general. The first time it was located (Bosch 2001[19]) it was described as H102 and included 7 Basques and one Andalusian.

R-M167 (also SRY2627): The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[20]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000, Rosser[21] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001, Bosch[22] described this marker as H103, in 5 Basques and 5 Catalans. Further regional studies[23] have located it in significative amounts in Asturias, Cantabria and Galicia, as well as again among Basques. Cases in the Azores and Latin America have also been reported. A total of 85 individuals with this haplogroup have been found so far, almost all of them in academic studies, making it the best documented R1b1b2 subclade[24].

In 2008, two research papers by López-Parra[18] and Adams[17] respectively, identified it as very important in all the Pyrenees, with some presence further south in Iberia (specially in the Eastern half but also in Northern Portugal). It is specially prevalent among Catalans, where it includes some 20% of all men.

The R-U152 (formerly R1b1c10) subclade i (also called S28) and its discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry's commercial and research branches have shown that U152 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both U106 and U152. Like U106, U152's specifications were not initially officially published by EthnoAncestry against their previous assertions that data would be publicly published; but again the marker was subsequently identified independently by Sims et al (2007). [15]

A recent Y-SNP to surface is S68 which was reported by EthnoAncestry in 2007. It was originally considered to be what was once referred to as a "private SNP" and by EthnoAncestry as a "Family SNP", but was recently seen in someone from another part of Europe, and with a different surname. It is only with continued research that the time depth of these markers can be estimated. At present S68 has been seen in an individual from Scotland and another from Sweden. EthnoAncestry has determined that this subclade is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.

Early results as of November 2008 suggest that R-L21 is common in the British Isles, and is yet to be observed so far in Iberian ancestry. Its subclade R-M222 is particularly associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1b2a1b6b is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.

Other subclades

Besides the ubiquitous R1b1b2, other subclades descended from haplogroup R1b1 have been identified, including R1b1b1 (M73), R1b1a (M18), and R1b1c (M335). Haplogroup R1b1b1 (M73), which represents the closest patrilineal relatives of haplogroup R1b1b2 (M269), has been found in SE Europe and SW Asia[25] and at generally low frequencies throughout central Eurasia. Haplogroup R1b1a (M18) has been found only at low frequencies in samples from Sardinia and Lebanon. Haplogroup R1b1c-M335 has been identified in Cameroon[25] and in a sample from Turkey.[26]

Though African haplogroup R chromosomes are generally quite rare, R-P25* (R1b1*) chromosomes are found at remarkably high frequencies in northern Cameroon (60.7–94.7%),[27] especially among the Ouldeme of Northern Cameroon in west central Africa, aging at least 4,100 years.[28] R1*-M173 are also observed in the Bantu of southern Cameroon (14.3%), Oman (10.7%), Egypt (6.8%), and the Hutu (1.4%). Whereas the R1*-M173 undifferentiated lineage is present in all four populations, the two downstream mutations, M17 (R1a1) and M269 (R1b1b2), are confined to Egypt and Oman. It is plausible that the African and Omani R1*-M173 chromosomes may be relics of an ancient back migration from Asia to Africa, which may have been a southern branch of an Upper Paleolithic westward expansion of this clade. The antiquity of the M173 backflow is implied by the total lack in sub-Saharan Africa of downstream mutations R1a1-M17 and R1b1b2-M269, associated with the post–Last Glacial Maximum (LGM) reinhabitation of Eurasia.[29]

Distribution

More specifically, its frequency is highest in Atlantic Europe.

Europe

In southern England, the frequency of R1b is about 70%, and in parts of north and western England, France, Wales, Scotland, and Ireland the frequency of R1b is greater than 90%.

It is also found at lower frequencies in Portugal (60%)[30], Spain (58%) [31], Italy continental Italy (40%)[32], Sicily (24.5%)[33], Sardinia (19%) [34] and Germany (39%)[35].

In eastern Europe, R1b is found at much lower frequencies in Poland (11.6%)[36]. Other studies show: Slovenia: 21%; Croatia (mainland): 15.7%; Czech Republic & Slovakia: 35.6%; Poland: 16.4%; Bulgaria: 17.0%; Serbia: 10.6%; Greece: 22.8%; Cyprus: 9.0%; Albania: 17.6%; Romania: 18.0%; Hungary: 13.3%, Lithuania: 5%, Estonia: 9%, Latvia 15%.[37]

North Africa

Asia

Studies from Volga-Urals on the border of Europe and Asia have revealed high frequencies of R1b1b2 in Bashkirs, although the genetic diversity is low, suggesting a founder effect.[56]

Haplotypes

Modal

Recognizable instances of a modal haplotype have been noted within the R1b haplogroup.

One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 33% in Portugal while the highest value is to be found among Spanish Basques. This has additionally been referenced in literature as Haplotype 15.

Another haplotype of R1b, with DYS393=12, has been referenced in the literature as Haplotype 35, or ht35[59]. They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the Last Glacial Maximum instead of in Iberia. Descendants can be found in high numbers in the Armenian Highland and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is theorized to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until later being absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, most likely with the arrival of Roman soldiers.

Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Early Middle Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1b2a1b6b.

Mutation

The technical details of M343 (rs9786184) are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5'? 3': tttaacctcctccagctctgca
Reverse 5'? 3': acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

Popular culture

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.

See also

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L M NO P S T
| |
N O Q R
Haplogroup R
Haplogroup R1
Haplogroup R1a

Haplogroup R1a1




Haplogroup R1b




Haplogroup R2



References

  1. ^ Tatiana M. Karafet, Fernando L. Mendez, Monica B. Meilerman, Peter A. Underhill, Stephen L. Zegura, and Michael F. Hammer (2008). New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree
  2. ^ 13/32, Y-Chromosome Variation Among Sudanese:Restricted Gene Flow, Concordance With Language, Geography, and History, Hassan et al. 2008
  3. ^ 11/102, "Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample"., Robino et al. 2008
  4. ^ Cinnioglu, Cengiz; et al (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. 
  5. ^ Y Chromosome Consortium (2002-01-18). "YCC NRY Tree 2002". Retrieved on 2007-12-13.
  6. ^ a b "Variations of R1b Ydna in Europe: Distribution and Origins".
  7. ^ a b International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades - 2009
  8. ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Research, 2008. New binary polymorphisms reshape and increase the resolution of the human Y chromosomal haplogroup tree
  9. ^ The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective - Ornella Semino et al., 2000
  10. ^ Excavating Y-chromosome haplotype strata in Anatolia, Cinnioglu et al., 2003
  11. ^ Rapid ecological turnover and its impact on Neanderthal and other human populations - Clive Finlayson and Jose´ S. Carrión, Trends in Ecology & Evolution, Volume 22, Issue 4, April 2007, Pages 213-222 [1]
  12. ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Research, 2008. New binary polymorphisms reshape and increase the resolution of the human Y chromosomal haplogroup tree
  13. ^ Arredi, Poloni and Tyler-Smith (2007), "The Peopling of Europe", Michael Crawford, Anthropological Genetics, pp. 380-408, http://books.google.ca/books?id=tlSspaBLkhoC&pg=PA380&lpg=PA394#PPA394,M1 
  14. ^ [2] A Genetic Signal of Central European Celtic Ancestry: Preliminary Research Concerning Y-Chromosome Marker S28 / U152 - David K. Faux
  15. ^ a b [3] Y-chromosome Short Tandem Repeat DYS458.2 Non-consensus Alleles Occur Independently in Both Binary Haplogroups J1-M267 and R1b3-M405, The Croatian Medical Journal, Vol. 48, No. 4. (August 2007), pp. 450-459
  16. ^ McEwan's Genealogy Page: "R1b1c4 aka M153"
  17. ^ a b Susan M. Adams et al, The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula. AJHG, 2008
  18. ^ a b A.M. López-parra et al, In search of the Pre- and Post-Neolithic Genetic Substrates in Iberia: Evidence from Y-Chromosome in Pyrenean Populations. Annals of Human Genetics 2008
  19. ^ Bosch et al, High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
  20. ^ M.E. Hurles et al, Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism, 1999
  21. ^ Z.H. Rosser et al, Y-Chromosomal Diversity in Europe Is Clinal and Influenced Primarily by Geography, Rather than by Language, 2000
  22. ^ Bosch et al High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
  23. ^ McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"
  24. ^ McEwan's Genealogy Page: "Summary of published results in the R subclade"
  25. ^ a b [4] Dennis Wright - The Irish Type III Website
  26. ^ [5] Excavating Y-chromosome haplotype strata in Anatolia - Cengiz Cinnioglu et al., Hum Genet (2004) 114 : 127–148, DOI 10.1007/s00439-003-1031-4
  27. ^ [6] Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes - Elizabeth T. Wood et al., European Journal of Human Genetics (2005) 13, 867–876
  28. ^ [7] A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes Fulvio Cruciani et al.,Am. J. Hum. Genet. 70:1197–1214, 2002
  29. ^ [8] The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations - J. R. Luis et al., Am. J. Hum. Genet. 74:000–000, 2004
  30. ^ 395/657, Micro-Phylogeographic and Demographic of Portuguese Male Lineages, Beleza et al. 2005
  31. ^ 582/1002, The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula, Adams et al. 2008
  32. ^ 280/699, Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter, Capelli et al. 2007
  33. ^ 57/232, Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome, Gaetano et al. 2008
  34. ^ 174/930, Y-Chromosome Based Evidence for Pre-Neolithic Origin of the Genetically Homogeneous but Diverse Sardinian Population: Inference for Association Scans, Contu et al. 2008
  35. ^ 473/1215, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
  36. ^ 106/913, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
  37. ^ Oxford Journals [9]
  38. ^ 13/32, Y-Chromosome Variation Among Sudanese:Restricted Gene Flow, Concordance With Language, Geography, and History, Hassan et al. 2008
  39. ^ 43/445, Hassan et al. 2008
  40. ^ 6/147, Luis et al. 2001
  41. ^ 11/102, Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample
  42. ^ 10/139 Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula , Adams et al. 2008
  43. ^ 3/54 Arredi et al. 2004
  44. ^ Combined Adams et al. 2008; Bosch et al. 2001 and Maria Brotilini et al. 2004
  45. ^ 18/45, Flores et al. (2005), Isolates in a corridor of migrations: a high-resolution analysis. of Y- chromosome variation in Jordan
  46. ^ 238/734, Weale et al. (2004)
  47. ^ Oxford Journals [10]
  48. ^ 76/523, Y-Chromosome Excavating Y-chromosome haplotype strata in Anatolia, Cinnioglu et al. 2004
  49. ^ 16/139, Zaheri et al. 2003,Y-chromosome and mtDNA polymorphisms in Iraq
  50. ^ Wells et al. (2001), Nebel et al. (2001), Nasidze et al. (2005), Cruciani et al. (2004)
  51. ^ Semino et al. (2000), Hammer et al. (2000), Di Giacomo et al. (2004), Cruciani et al. 2004
  52. ^ Nebel et al. (2001),Cruciani et al. (2004), Hammer et al. (2000)
  53. ^ Flores et al. (2005) Isolates in a corridor of migrations: a high-resolution analysis. of Y- chromosome variation in Jordan
  54. ^ Wells et al. (2001), Semino et al. (2000), Hammer et al. (2000), Semino et al. (2004), Zalloua et al. (2008) 74/935, Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events, Zalloua et al. 2008
  55. ^ 7/164, Cadenas et al. 2008
  56. ^ A. S. Lobov et al. - Y chromosome analysis in subpopulations of Bashkirs from Russia, 2005
  57. ^ Qamar et al. (2002), Cruciani et al. (2004), Semino et al. (2004), Underhill et al. (2000)
  58. ^ 13/176 in Pakistan and 4/728 in India, Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists, Sengupta et al. 2008
  59. ^ http://freepages.genealogy.rootsweb.com/~gallgaedhil/haplo_r1b_ht35.htm Haplogroup R1b (Haplotype 35)

External links

Maps

Projects